Detail of EST/Unigene BF005498 |
Acc. | BF005498 |
Internal Acc. | EST433996 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=6e-35; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=6e-35; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=6e-35; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=1e-34; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=5e-34; |
Length | 378 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | AAAATGGCCGCATGATCCATGGCTCTCTCTTCACCAACCTTGGCTGGCAAGCCGGTCAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |