Detail of EST/Unigene BF005769 |
Acc. | BF005769 |
Internal Acc. | EST434267 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=5e-28; Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=4e-26; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=5e-26; Galactolipase DONGLE, chloroplastic OS=Arabidopsis thaliana E-value=5e-17; Phospholipase A1-Ialpha2, chloroplastic OS=Arabidopsis thaliana E-value=2e-15; |
Length | 505 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | AACACCCTCAACCAACATTCTATCCTCCATATCCTTCCCATTCCCACCATCTCTTTTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841569 |
Trichome-related Gene from Literature | N/A |