Detail of EST/Unigene BF005842 |
Acc. | BF005842 |
Internal Acc. | EST434331 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=4e-41; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=6e-17; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=2e-16; Carbonic anhydrase OS=Flaveria pringlei E-value=5e-14; |
Length | 293 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | ACTTCTAACTTCCCTTCTCTTATTCAAGACAAGCCTGTTTTTGCTTCATCTTCTTCTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |