| Detail of EST/Unigene BF005854 |
| Acc. | BF005854 |
| Internal Acc. | EST434352 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-29; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=6e-27; Oxygen-evolving enhancer protein 2, chloroplastic OS=Cucumis sativus E-value=6e-27; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=1e-26; Oxygen-evolving enhancer protein 2-3, chloroplastic OS=Nicotiana tabacum E-value=2e-26; |
| Length | 364 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | GAAACAGTATTTCAACATATCAGTTTTGACAAGGACTGCTGATGGCGATGAAGGTGGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817630 |
| Trichome-related Gene from Literature | N/A |