Detail of EST/Unigene BF006371 |
Acc. | BF006371 |
Internal Acc. | EST434869 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=2e-89; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=4e-84; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=4e-22; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=9e-22; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=5e-20; |
Length | 548 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | TGTCGTCATCATCTCTTACTTTTGCAGCTGAAGCTGTGAGACAGAGTTTTGGAGCAAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |