Detail of EST/Unigene BF006438 |
Acc. | BF006438 |
Internal Acc. | EST434936 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipid hydroperoxide glutathione peroxidase, chloroplastic OS=Pisum sativum E-value=4e-79; Phospholipid hydroperoxide glutathione peroxidase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-57; Putative glutathione peroxidase 7, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=4e-45; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=3e-44; |
Length | 588 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | GTGATTGTGAACAACGCAAAATGGTTTCCATGGCTTCTTCCACAACATTCTTCACACCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817046 |
Trichome-related Gene from Literature | N/A |