| Detail of EST/Unigene BF006451 |
| Acc. | BF006451 |
| Internal Acc. | EST434949 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 22 kDa protein, chloroplastic OS=Spinacia oleracea E-value=2e-47; Photosystem II 22 kDa protein, chloroplastic OS=Arabidopsis thaliana E-value=5e-45; Photosystem II 22 kDa protein, chloroplastic OS=Solanum lycopersicum E-value=6e-45; Photosystem II 22 kDa protein, chloroplastic OS=Solanum sogarandinum E-value=8e-45; Photosystem II 22 kDa protein, chloroplastic OS=Nicotiana tabacum E-value=2e-44; |
| Length | 660 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | AAACACAAGCAAGAGCTAACATAGTATAGCAATGGCTCAAACTATGTTACTCATGTCTAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841033 |
| Trichome-related Gene from Literature | N/A |