| Detail of EST/Unigene BF006605 |
| Acc. | BF006605 |
| Internal Acc. | EST435103 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, chloroplastic OS=Glycine max E-value=0; Omega-6 fatty acid desaturase, chloroplastic OS=Brassica napus E-value=0; Omega-6 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=0; Omega-6 fatty acid desaturase, chloroplastic OS=Spinacia oleracea E-value=0; Fatty acid desaturase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-70; |
| Length | 645 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | AAACAAATTGGTAGAAGACATTGTTGGAACTCTGGCCTTTTTGCCACTAATTTATTCATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.19.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829220 |
| Trichome-related Gene from Literature | N/A |