| Detail of EST/Unigene BF006615 |
| Acc. | BF006615 |
| Internal Acc. | EST435113 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=4e-24; Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=8e-24; Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-23; Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-22; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=6e-22; |
| Length | 165 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSLC; |
| Sequence | GTGAAACCTGGCACATGGTTTTCAGCACTGAGGGAGAGGTTCCTTACAGAGAAGGACAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836751 |
| Trichome-related Gene from Literature | N/A |