Detail of EST/Unigene BF006728 |
Acc. | BF006728 |
Internal Acc. | EST435226 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Pisum sativum E-value=2e-60; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Phaseolus vulgaris E-value=5e-56; Carotenoid 9,10(9',10')-cleavage dioxygenase OS=Crocus sativus E-value=4e-52; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=4e-52; 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic OS=Zea mays E-value=2e-20; |
Length | 352 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSLC; |
Sequence | GGAGAAGATTTTTGTGAAGTTGTTTTATGATTCTTCGGTTCCTCATCATTGGCTTGCTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.99.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825527 |
Trichome-related Gene from Literature | N/A |