| Detail of EST/Unigene BF518510 |
| Acc. | BF518510 |
| Internal Acc. | EST455957 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable carotenoid cleavage dioxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; Zeaxanthin 7,8(7',8')-cleavage dioxygenase, chromoplast OS=Crocus sativus E-value=7e-07; 9-cis-epoxycarotenoid dioxygenase NCED9, chloroplastic OS=Arabidopsis thaliana E-value=3e-06; 9-cis-epoxycarotenoid dioxygenase NCED3, chloroplastic OS=Arabidopsis thaliana E-value=4e-06; |
| Length | 139 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | GGGGAAGAAGAGTAGGTTTGTTTATGCAGCGATTGGGAATCCAATGCCAAAGTTTTCGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827655 |
| Trichome-related Gene from Literature | N/A |