| Detail of EST/Unigene BF518611 |
| Acc. | BF518611 |
| Internal Acc. | EST456060 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=3e-57; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=8e-55; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=2e-54; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=2e-54; Probable glycine cleavage system H protein 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-53; |
| Length | 439 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CTTAACAATGGCACTGAGGATGTGGGCTTCTTCAACTGCCAATGCTCTCAAACTCTCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840141 |
| Trichome-related Gene from Literature | N/A |