| Detail of EST/Unigene BF518652 |
| Acc. | BF518652 |
| Internal Acc. | EST456102 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=6e-48; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=4e-26; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=6e-25; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=4e-24; Carbonic anhydrase OS=Flaveria brownii E-value=3e-21; |
| Length | 408 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | TACATTGAGACCTATTGTTTCTGCATCTGTTAACTCTTCTTGTTCTTGCTCTGCCACTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821134 |
| Trichome-related Gene from Literature | N/A |