| Detail of EST/Unigene BF518717 |
| Acc. | BF518717 |
| Internal Acc. | EST456168 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=2e-51; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=3e-39; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=1e-37; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=6e-34; 50S ribosomal protein L9 OS=Cyanothece sp. (strain PCC 7425 / ATCC 29141) E-value=3e-15; |
| Length | 507 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CAACAATGGCATCATCATCAACATTATCTTCACTTCCATTGCAACATAGTTTCACCTCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823623 |
| Trichome-related Gene from Literature | N/A |