Detail of EST/Unigene BF518726 |
Acc. | BF518726 |
Internal Acc. | EST456178 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent D-sorbitol-6-phosphate dehydrogenase OS=Malus domestica E-value=2e-51; NAD(P)H-dependent D-xylose reductase OS=Pachysolen tannophilus E-value=3e-21; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) E-value=3e-21; Aldose reductase C OS=Dictyostelium discoideum E-value=4e-21; Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=5e-21; |
Length | 499 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TGAACAGCGGATTCAAGATGCCAATCATTGGACTTGGAGTTTGGCGCATGGAAGGACAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816664 |
Trichome-related Gene from Literature | N/A |