Detail of EST/Unigene BF518738 |
Acc. | BF518738 |
Internal Acc. | EST456192 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=5e-35; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-26; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=6e-24; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-22; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-22; |
Length | 545 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CATTCTCTCTTAAAGCCATAAACTTTCTTCAACCCAACTCACAGAATTCAAAAGGGTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |