Detail of EST/Unigene BF518806 |
Acc. | BF518806 |
Internal Acc. | EST456262 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sphingosine kinase A OS=Dictyostelium discoideum E-value=1e-16; Sphingosine kinase B OS=Dictyostelium discoideum E-value=3e-11; Sphingosine kinase 2 OS=Mus musculus E-value=8e-11; Sphingosine kinase 2 OS=Homo sapiens E-value=2e-10; Sphingosine kinase 1 OS=Mus musculus E-value=3e-09; |
Length | 293 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | AAATCTCTGCTTGATTCAATTGGTGATCCTTGCGCAATAGCCAATGCCGTTCTTGCCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K04718 sphingosine kinase; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04718 sphingosine kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04718 sphingosine kinase |
EC | 2.7.1.91 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |