Detail of EST/Unigene BF519088 |
Acc. | BF519088 |
Internal Acc. | EST456548 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=2e-70; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=2e-67; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=9e-67; Probable glycine cleavage system H protein 2, mitochondrial OS=Arabidopsis thaliana E-value=4e-65; Glycine cleavage system H protein 1, mitochondrial OS=Arabidopsis thaliana E-value=4e-63; |
Length | 730 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CAAAGAAGCAGAAGTAGTCTTAACAATGGCACTGAGGATGTGGGCTTCTTCAACTGCCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840141 |
Trichome-related Gene from Literature | N/A |