Detail of EST/Unigene BF519142 |
Acc. | BF519142 |
Internal Acc. | EST456603 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosome-recycling factor, chloroplastic OS=Arabidopsis thaliana E-value=2e-45; Ribosome-recycling factor, chloroplastic (Fragment) OS=Daucus carota E-value=5e-45; Ribosome-recycling factor, chloroplastic OS=Spinacia oleracea E-value=6e-44; Ribosome-recycling factor, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-38; Ribosome-recycling factor, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-38; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TCGTGCCGAATCGGCACGAGGCTCTTTCTCTTCAACAACACCACTCCGTTCTATCTTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825494 |
Trichome-related Gene from Literature | N/A |