| Detail of EST/Unigene BF519148 |
| Acc. | BF519148 |
| Internal Acc. | EST456609 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-amyrin 24-hydroxylase OS=Glycine max E-value=2e-48; Cytochrome P450 93A2 OS=Glycine max E-value=1e-24; Cytochrome P450 93A3 OS=Glycine max E-value=4e-24; Cytochrome P450 93A1 OS=Glycine max E-value=6e-22; Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=1e-18; |
| Length | 524 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | AACTATTGGGACAATCCATTAGTGTTTAACCCTGAAAGATTCTTACAAAGTGATGATCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04403 TAK1-binding protein 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841474 |
| Trichome-related Gene from Literature | N/A |