Detail of EST/Unigene BF519207 |
Acc. | BF519207 |
Internal Acc. | EST456668 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-35; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-35; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-34; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-34; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-34; |
Length | 334 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TACCACAATGGCTGCTTCAACAATGTCCCTCTCTTCTTCATCATTTGTCGGGAAGGCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |