| Detail of EST/Unigene BF519250 |
| Acc. | BF519250 |
| Internal Acc. | EST456712 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glucuronoxylan glucuronosyltransferase IRX7 OS=Arabidopsis thaliana E-value=2e-56; Probable glucuronoxylan glucuronosyltransferase F8H OS=Arabidopsis thaliana E-value=5e-52; Probable glucuronosyltransferase Os03g0107900 OS=Oryza sativa subsp. japonica E-value=3e-47; Probable glucuronosyltransferase Os01g0926400 OS=Oryza sativa subsp. japonica E-value=3e-29; Probable glucuronosyltransferase Os01g0926700 OS=Oryza sativa subsp. japonica E-value=2e-28; |
| Length | 510 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | AAATTCAACGGTGACCGGAGGTTTTACCTACGGAGACATAGGTTTGCCGGTTACCAGTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2 |
| EC | 2.4.1.224 2.4.1.225 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817357 |
| Trichome-related Gene from Literature | N/A |