| Detail of EST/Unigene BF519304 |
| Acc. | BF519304 |
| Internal Acc. | EST456766 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aminomethyltransferase, mitochondrial OS=Pisum sativum E-value=0; Aminomethyltransferase, mitochondrial OS=Solanum tuberosum E-value=0; Aminomethyltransferase, mitochondrial OS=Flaveria anomala E-value=0; Aminomethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=0; Aminomethyltransferase, mitochondrial OS=Mesembryanthemum crystallinum E-value=0; |
| Length | 670 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CTTTTATGACCAAATCTCTTCTTCTTCATCTTCATTGATTCCGAACACAACCATAACAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K00605 aminomethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00605 aminomethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00605 aminomethyltransferase |
| EC | 2.1.2.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837733 |
| Trichome-related Gene from Literature | N/A |