| Detail of EST/Unigene BF519306 |
| Acc. | BF519306 |
| Internal Acc. | EST456768 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-62; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-55; Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-55; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-35; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; |
| Length | 613 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | ATAGCATTTACACCTTCATTCATTCTCTTTTGTGTAAGTGTAAATGGCACTACACATTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828722 |
| Trichome-related Gene from Literature | N/A |