Detail of EST/Unigene BF519306 |
Acc. | BF519306 |
Internal Acc. | EST456768 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-62; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-55; Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-55; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-35; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; |
Length | 613 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | ATAGCATTTACACCTTCATTCATTCTCTTTTGTGTAAGTGTAAATGGCACTACACATTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828722 |
Trichome-related Gene from Literature | N/A |