Detail of EST/Unigene BF519492 |
Acc. | BF519492 |
Internal Acc. | EST456955 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase I OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) E-value=5e-20; Pyruvate kinase I OS=Salmonella typhi E-value=5e-20; Pyruvate kinase I OS=Escherichia coli (strain K12) E-value=2e-19; Pyruvate kinase I OS=Escherichia coli O157:H7 E-value=2e-19; Pyruvate kinase OS=Dictyostelium discoideum E-value=1e-18; |
Length | 483 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GCTTCTTCAGAGATATTGCCAATCAACTTTGATGGACTGGCCCAGGCAGTGAAGACGGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824465 |
Trichome-related Gene from Literature | N/A |