| Detail of EST/Unigene BF519555 |
| Acc. | BF519555 |
| Internal Acc. | EST457019 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=7e-13; 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=7e-13; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Spinacia oleracea E-value=3e-09; |
| Length | 162 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CCACATCCACACTCTCTGTATCCCAACCCCAATACCTTCCATCAATCAAAGCTATGAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844324 |
| Trichome-related Gene from Literature | 844324 |