Detail of EST/Unigene BF519615 |
Acc. | BF519615 |
Internal Acc. | EST457079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=9e-94; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=5e-68; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=4e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=4e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum tuberosum E-value=9e-36; |
Length | 644 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CCTCAGCGTTTCATTCATCTTCTTCCTTCCTTCCCAATTTCCTCCAATGGCTCTTTCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |