| Detail of EST/Unigene BF519701 |
| Acc. | BF519701 |
| Internal Acc. | EST457165 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-43; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-38; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=6e-30; Putative nitrogen fixation protein YutI OS=Bacillus subtilis (strain 168) E-value=6e-17; NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; |
| Length | 464 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | GTGGTGGTGCTCAACACACAATCTTACTGCAGAACTGTCCTTCAACCTTCTTCTTTCACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835057 |
| Trichome-related Gene from Literature | N/A |