Detail of EST/Unigene BF519757 |
Acc. | BF519757 |
Internal Acc. | EST457221 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U18 OS=Arabidopsis thaliana E-value=2e-55; Glutathione S-transferase U17 OS=Arabidopsis thaliana E-value=3e-55; Glutathione S-transferase U16 OS=Arabidopsis thaliana E-value=2e-53; Glutathione S-transferase U15 OS=Arabidopsis thaliana E-value=1e-49; Probable glutathione S-transferase GSTU6 OS=Oryza sativa subsp. japonica E-value=3e-44; |
Length | 597 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CAAATTGCCCTTTCCATCAAAGGTTTGGATTATGAGAACATTGTAGAAAACTTGAATTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837575 |
Trichome-related Gene from Literature | N/A |