| Detail of EST/Unigene BF519900 |
| Acc. | BF519900 |
| Internal Acc. | EST457365 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=9e-53; Oxygen-evolving enhancer protein 3, chloroplastic OS=Onobrychis viciifolia E-value=6e-52; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-49; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=2e-47; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=2e-43; |
| Length | 610 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | AAGTCTTCAACTGAGTGGCTCAAACAGGTTGAACATGTTGCATGGTAGCAACAGTAACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825866 |
| Trichome-related Gene from Literature | N/A |