Detail of EST/Unigene BF520044 |
Acc. | BF520044 |
Internal Acc. | EST457512 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-53; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=4e-53; Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=1e-52; Probable glutathione S-transferase MSR-1 OS=Nicotiana plumbaginifolia E-value=5e-51; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=3e-50; |
Length | 422 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TTTGTTGTTACAAATGAACCCTGTTCATAAGAAAATCCCTGTTCTTATTCATAATGGTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838289 |
Trichome-related Gene from Literature | N/A |