Detail of EST/Unigene BF520152 |
Acc. | BF520152 |
Internal Acc. | EST457621 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase OS=Glycine max E-value=7e-96; Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=9e-90; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=1e-88; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=3e-86; Linoleate 9S-lipoxygenase 1 OS=Phaseolus vulgaris E-value=2e-85; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TGGGTTCAAGACTATGTCTCTTTATATTATCCAACAGATGAAGTAGTGCAAAAGGACACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; |
EC | 1.13.11.- 1.13.11.34 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841944 |
Trichome-related Gene from Literature | 841944 |