| Detail of EST/Unigene BF520274 |
| Acc. | BF520274 |
| Internal Acc. | EST457744 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 22 kDa protein, chloroplastic OS=Spinacia oleracea E-value=3e-28; Photosystem II 22 kDa protein, chloroplastic OS=Arabidopsis thaliana E-value=5e-25; Photosystem II 22 kDa protein, chloroplastic OS=Nicotiana tabacum E-value=1e-24; Photosystem II 22 kDa protein, chloroplastic OS=Solanum lycopersicum E-value=2e-24; Photosystem II 22 kDa protein, chloroplastic OS=Solanum sogarandinum E-value=5e-24; |
| Length | 531 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | GAGCTAACATAGTATAGCAATGGCTCAAACTATGTTCTCATGTCTAGTGTCTCTAGTACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841033 |
| Trichome-related Gene from Literature | N/A |