Detail of EST/Unigene BF520399 |
Acc. | BF520399 |
Internal Acc. | EST457869 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-71; PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-32; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; PsbP domain-containing protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; Oxygen-evolving enhancer protein 2, chloroplastic OS=Cucumis sativus E-value=3e-06; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TTGCTTCGGAATACTACAACTTCATCTTCTAACAATGTCTCTTGTGCAATGGAAACAACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818532 |
Trichome-related Gene from Literature | N/A |