Detail of EST/Unigene BF520420 |
Acc. | BF520420 |
Internal Acc. | EST457890 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable aldo-keto reductase 1 OS=Glycine max E-value=6e-75; Perakine reductase OS=Rauvolfia serpentina E-value=2e-59; Probable aldo-keto reductase 2 OS=Oryza sativa subsp. japonica E-value=1e-43; Probable aldo-keto reductase 2 OS=Oryza sativa subsp. indica E-value=1e-43; Probable aldo-keto reductase 4 OS=Arabidopsis thaliana E-value=2e-42; |
Length | 563 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GGTCTCTTTGGACTCGCGACATTGAGGAGGAGATAGTTCCTCTCTGTTTAGAGCTTGGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
EC | 1.1.1.2 |
Transcription Factor Family | |
Transporter Classification Family | 8.A.5 Voltage-gated K+ channel b-subunit VICb |
Probeset |
|
Corresponding NCBI Gene | 842365 |
Trichome-related Gene from Literature | N/A |