| Detail of EST/Unigene BF520539 |
| Acc. | BF520539 |
| Internal Acc. | EST458011 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase small chain C OS=Arabidopsis thaliana E-value=4e-56; Putative ribonucleoside-diphosphate reductase small chain B OS=Arabidopsis thaliana E-value=6e-56; Ribonucleoside-diphosphate reductase small chain OS=Nicotiana tabacum E-value=8e-56; Ribonucleoside-diphosphate reductase small chain A OS=Arabidopsis thaliana E-value=2e-50; Ribonucleoside-diphosphate reductase subunit M2 B OS=Mus musculus E-value=3e-46; |
| Length | 421 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | GAAATGGATCGATTCAAGCGATTCTTTTGCAGAAAGAATCGTTGCGTTTGCTTGTGTTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
| EC | 1.17.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822324 |
| Trichome-related Gene from Literature | N/A |