Detail of EST/Unigene BF520650 |
Acc. | BF520650 |
Internal Acc. | EST458123 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=7e-66; Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=1e-65; Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic OS=Nicotiana tabacum E-value=8e-61; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=2e-60; Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-57; |
Length | 534 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TTGATTCTTCCAATAACAACATGGCTGCTGCAGTAACAGCCGCCGTCTCTTTTCCATACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836751 |
Trichome-related Gene from Literature | N/A |