Detail of EST/Unigene BF520811 |
Acc. | BF520811 |
Internal Acc. | EST458284 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent D-sorbitol-6-phosphate dehydrogenase OS=Malus domestica E-value=3e-79; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) E-value=2e-38; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) E-value=3e-38; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fumigata (strain CEA10 / CBS 144.89 / FGSC A1163) E-value=3e-38; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Aspergillus terreus (strain NIH 2624 / FGSC A1156) E-value=3e-37; |
Length | 602 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TGGCAATCACACTGAACAGCGGATTCAAGATGCCAATCATTGGACTTGGAGTTTGGCGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
EC | 1.1.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816664 |
Trichome-related Gene from Literature | N/A |