Detail of EST/Unigene BF520817 |
Acc. | BF520817 |
Internal Acc. | EST458290 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=7e-71; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=4e-70; Thiamine thiazole synthase 2, chloroplastic OS=Sorghum bicolor E-value=8e-69; Thiamine thiazole synthase 1, chloroplastic OS=Zea mays E-value=1e-68; Thiamine thiazole synthase 2, chloroplastic OS=Zea mays E-value=3e-68; |
Length | 510 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GCAACTCCCAAATCCTCATTCTTCAATGGAAGACCAATTGCTACCCGCACCTCCACCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835567 |
Trichome-related Gene from Literature | N/A |