Detail of EST/Unigene BF520855 |
Acc. | BF520855 |
Internal Acc. | EST458328 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=2e-42; Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=8e-41; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=1e-32; Cytochrome P450 82A4 OS=Glycine max E-value=1e-23; Cytochrome P450 82G1 OS=Arabidopsis thaliana E-value=3e-23; |
Length | 523 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GGTGACATTTCAAAACTTCCTTATCTTCAAAGCATTGTCTATGAAACCCTTCGACTACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829890 |
Trichome-related Gene from Literature | N/A |