| Detail of EST/Unigene BF520951 |
| Acc. | BF520951 |
| Internal Acc. | EST458424 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=2e-52; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=2e-51; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=2e-50; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=4e-50; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=6e-50; |
| Length | 562 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | TACCAAACAGGCCTGTGCTTTTAGGGATTCATATGAAAAGTTCAAGAAAGCAGGAGCAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.11.1.15 1.11.1.7 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |