Detail of EST/Unigene BF520975 |
Acc. | BF520975 |
Internal Acc. | EST458457 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UPF0160 protein OS=Dictyostelium discoideum E-value=7e-38; UPF0160 protein MYG1, mitochondrial OS=Rattus norvegicus E-value=2e-35; UPF0160 protein MYG1, mitochondrial OS=Mus musculus E-value=3e-35; UPF0160 protein MYG1, mitochondrial OS=Bos taurus E-value=9e-35; UPF0160 protein MYG1, mitochondrial OS=Homo sapiens E-value=2e-34; |
Length | 547 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GTTTATAAGCATTTTGGAAAAGAGATTATAGCTAATGAACTTAAGGTAGATGAAGAGCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834202 |
Trichome-related Gene from Literature | N/A |