| Detail of EST/Unigene BF521029 |
| Acc. | BF521029 |
| Internal Acc. | EST458502 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-isopropylmalate dehydratase OS=Arabidopsis thaliana E-value=8e-93; Isopropylmalate/citramalate isomerase large subunit OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=3e-45; 3-isopropylmalate dehydratase large subunit 1 OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) E-value=2e-43; 3-isopropylmalate dehydratase large subunit 1 OS=Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938) E-value=2e-43; 3-isopropylmalate dehydratase large subunit OS=Syntrophus aciditrophicus (strain SB) E-value=4e-42; |
| Length | 555 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | ATACCTGACCACTATATATTCACAAGCGATGAACGTGCGAATCGCAATGTTGACATACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
| EC | 4.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826975 |
| Trichome-related Gene from Literature | N/A |