Detail of EST/Unigene BF521120 |
Acc. | BF521120 |
Internal Acc. | EST458594 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=1e-75; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=1e-69; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=5e-53; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=4e-52; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-52; |
Length | 478 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CCATGGCATTGATGGCAGCAAGCTCAGCAGCTGTTGTTAAACAAACTCCTTTCCTTGGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |