Detail of EST/Unigene BF521199 |
Acc. | BF521199 |
Internal Acc. | EST458746 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable chlorophyll(ide) b reductase NYC1, chloroplastic OS=Arabidopsis thaliana E-value=4e-56; Probable chlorophyll(ide) b reductase NYC1, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-56; Chlorophyll(ide) b reductase NOL, chloroplastic OS=Arabidopsis thaliana E-value=1e-10; Chlorophyll(ide) b reductase NOL, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-10; |
Length | 355 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GGTGCAGGTTCTGGAGGCTCTAGCACACCTCTGACAGCCGTCTATGGTTCTACAAAATGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826942 |
Trichome-related Gene from Literature | N/A |