Detail of EST/Unigene BF521261 |
Acc. | BF521261 |
Internal Acc. | EST458672 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=2e-13; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=1e-12; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-12; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-12; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-12; |
Length | 224 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | ATATTTATTTGTTTACTTAGTAAACACTAAAATTCTACCATGGCTGCTTCAACAATGTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |