Detail of EST/Unigene BF521268 |
Acc. | BF521268 |
Internal Acc. | EST458679 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA reductase OS=Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383) E-value=1e-14; Putative steroid dehydrogenase let-767 OS=Caenorhabditis briggsae E-value=1e-14; 3-ketoacyl-CoA reductase OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) E-value=3e-14; 3-ketoacyl-CoA reductase OS=Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545) E-value=3e-14; Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=3e-14; |
Length | 312 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | ACCATTCTCAGATTCACTCTTCTTCTTCTCAACTGGTTCTATGTCAATTTTCTCAGACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |