| Detail of EST/Unigene BF521432 |
| Acc. | BF521432 |
| Internal Acc. | EST458899 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM 1990 / NBRC 0083 / IGC 2968) E-value=2e-66; GMP synthase [glutamine-hydrolyzing] OS=Aquifex aeolicus (strain VF5) E-value=3e-66; GMP synthase [glutamine-hydrolyzing] OS=Candida albicans (strain SC5314 / ATCC MYA-2876) E-value=5e-66; GMP synthase [glutamine-hydrolyzing] OS=Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) E-value=2e-65; GMP synthase [glutamine-hydrolyzing] OS=Agrobacterium tumefaciens (strain C58 / ATCC 33970) E-value=4e-65; |
| Length | 660 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | GGATCTTCATTTACCGGTTGAGTGTGTTGATGCTGCAGACCAATTTCTTACAAAGCTAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
| EC | 6.3.5.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842670 |
| Trichome-related Gene from Literature | N/A |