| Detail of EST/Unigene BF521433 |
| Acc. | BF521433 |
| Internal Acc. | EST458900 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L19, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-25; 39S ribosomal protein L11, mitochondrial OS=Homo sapiens E-value=4e-23; 39S ribosomal protein L11, mitochondrial OS=Rattus norvegicus E-value=9e-23; 39S ribosomal protein L11, mitochondrial OS=Bos taurus E-value=1e-22; 39S ribosomal protein L11, mitochondrial OS=Mus musculus E-value=4e-22; |
| Length | 642 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | TTCTCAACGCTTCCACTGTTTCGATTTCTCTCTCTGTATGATTTCTCCAGGTTAACAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829701 |
| Trichome-related Gene from Literature | N/A |