Detail of EST/Unigene BF521521 |
Acc. | BF521521 |
Internal Acc. | EST458997 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=8e-71; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=2e-44; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=2e-44; Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=2e-43; Glutathione S-transferase U5 OS=Arabidopsis thaliana E-value=1e-41; |
Length | 491 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CAATGGCTACAAANCAGGAACATGTGAAGCTTTTGGGAGCTACAGGAAGCCCATTTGTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
EC | 2.5.1.18 5.2.1.2 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |